The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused the pandemic of coronavirus disease 2019 (COVID-19), which has severely affected public health and the global economy. Adaptive immunity plays a crucial role in fighting SARS-CoV-2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients with severe COVID-19 have delayed and weak adaptive immune responses; however, the mechanism by which SARS-CoV-2 prevents adaptive immunity remains unclear.
Here, using an in vitro cell line, we report that the SARS-CoV-2 spike protein significantly inhibits DNA damage repair, which is necessary for effectiveV (D) J recombination in adaptive immunity.
Mechanically, we found that the spike protein localizes to the nucleus and inhibits DNA damage repair by preventing the recruitment of key DNA repair proteins BRCA1 and 53BP1 at the site of damage. Our findings reveal a potential molecular mechanism by which spike protein could impede adaptive immunity and highlight the potential side effects of long-duration spike-based vaccines.
Keywords: SARS - CoV - 2, spike, DNA damage repair, V (D) J recombination, vaccine
1. Introduction
The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is responsible for the current coronavirus disease 2019 (COVID-19) pandemic that has caused more than 2.3 million deaths. SARS-CoV-2 is an enveloped single positive sense RNA virus consisting of structural and non-structural proteins [1]. After infection, these viral proteins sequester and deregulate the host's cellular machinery to replicate, assemble, and spread progeny viruses [2].
Recent clinical studies have shown that SARS-CoV-2 infection dramatically affects the number and function of lymphocytes [3, 4, 5, 6]. Compared with mild and moderate survivors, patients with severe COVID-19 have significantly fewer total T cells, helper T cells, and suppressor T cells [3,4].
Furthermore, COVID-19 delays IgG and IgM levels after onset of symptoms [5,6]. Together, these clinical observations suggest that SARS-CoV-2 affects the adaptive immune system. However, the mechanism by which SARS-CoV-2 suppresses adaptive immunity remains unclear.
As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher organisms depend on to defend against various threats and tissue homeostasis. Emerging evidence indicates that these two systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major pathways of double-stranded DNA break (DSB) repair, non-homologous end junction repair (NHEJ) plays a critical role in recombination-activating gene endonuclease-mediated V (D) J recombination. lymphocyte-specific (RAG), resulting in a highly diverse repertoire of antibodies on B cells and T cell receptors (TCRs) on T cells [8].
For example, loss of function of key DNA repair proteins such as ATM, DNA-PKcs, 53BP1, et al., Leads to defects in NHEJ repair that inhibit the production of functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage through different mechanisms, such as induction of reactive oxygen species (ROS) production and host cell replication stress [12,13,14]. If DNA damage cannot be adequately repaired, it will contribute to the amplification of viral infection-induced pathology. Therefore, our goal was to investigate whether SARS-CoV-2 proteins hijack the DNA damage repair system, affecting adaptive immunity in vitro.
2. Materials and methods
2.1. Antibodies and reagents
Antibodies DAPI (Cat # MBD0015), doxorubicin (Cat # D1515), H2O2 (Cat # H1009) and β-tubulin (Cat # T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat # 12698), H2A (Cat # 12349), H2A.X (Cat # 7631), γ - H2A.X (Cat # 2577), Ku80 (Cat # 2753) and Rad51 (Cat # 8875 ))) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies 53BP1 (Cat # NB100-304) and RNF168 (Cat # H00165918-M01) were obtained from Novus Biologicals (Novus Biologicals, Littleton, CO, USA). Lamin B (Cat # sc - 374015), ATM (Cat # sc - 135663), DNA - PK (Cat # sc - 5282) and BRCA1 (Cat # sc - 28383) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The XRCC4 antibody (Cat # PA5-82264) was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
2.2. Plasmids
pHPRT-DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids # 26476 and # 26477) [15]. pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid # 44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike and nucleocapsid proteins were first synthesized with codon optimization and then cloned into a mammalian expression vector pUC57 with a 6xHis C-terminal tag. A 12-spacers RSS-GFP inverted complementary sequence was synthesized: a 23-spacers RSS was synthesized for the V (D) J reporter vector. The sequence was then cloned into the pBabe-IRES-mRFP vector to generate the pBabe reporter vector. -12RSS-GFPi-23RSS-IRES-mRFP. 12 spacers RSS sequence: 5 ′ - CACAGTGCTACAGACTGGAACAAAAACC - 3 ′. 23 - spacer RSS sequence: 5 ′ - CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC - 3 ′. RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid # 13328 and # 13329) [17].
23. Cells and cell culture
HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were grown under 5% CO2 at 37 ° C in Dulbecco's Modified Eagle's Medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) containing 10% (v / v) fetal calf serum (FCS, Gibco), 1% (v / v) penicillin (100 IU / ml), and streptomycin (100 μg / ml). Indicator cells HEK293T-DR-GFP and HEK293T-EJ5-GFP were generated as described above and cultured under 5% CO2 at 37 ° C in the culture medium mentioned above.
2.4. HR and NHEJ reporter essays
HR and NHEJ repair in HEK293T cells were measured as described above using stable DR-GFP and EJ5-GFP cells. Briefly, 0.5 x 10 6 stable HEK293T reporter cells were seeded in 6-well plates and transfected with 2 µg of expression plasmid I-SceI (pCBASceI) along with expression plasmids of SARS-CoV-2 proteins. Forty-eight hours after transfection and aspirin treatment, cells were harvested and analyzed by flow cytometric analysis for GFP expression. The means were obtained from three independent experiments.
2.5. Cell fractionation and immunoblotting
For the cell fraction assay, the subcellular protein fractionation kit (Thermo Fisher) was used according to the manufacturer's instructions. Protein lysates were quantitated using the BCA reagent (Thermo Fisher Scientific, Rockford, IL, USA). Proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose membranes (Amersham protran, 0.45 μm NC) and immunoblotted with primary antibodies followed by HRP-conjugated secondary antibodies. . Protein bands were detected using SuperSignal West Pico or Femto chemiluminescence kit (Thermo Fisher Scientific).
2.6. Comet test
Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis. Cells (1 x 105 cells / ml in cold phosphate buffered saline [PBS]) were resuspended in 1% low melting point agarose at 40 ° C at a ratio of 1: 3 vol / vol and pipetted into a CometSlide. The slides were then immersed in pre-cooled lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH> 13) for lysis overnight (18 -20 h) at 4 ° C in the dark. The slides were then carefully removed and immersed in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH> 12) at room temperature (RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V / cm. Finally, the slides were washed with distilled water, stained with propidium iodide 10 µg / mL, and analyzed by fluorescence microscopy. Twenty fields with approximately 100 cells in each sample were evaluated and quantified using Fiji software to determine tail length (tail moment).